Rapid communication: mapping the pig VCAM1 locus to chromosome 4 using a double-stranded conformation polymorphism marker (VCAM1-2).
نویسندگان
چکیده
Source and Description of Primers. We previously identified a SacI polymorphism by using a pig VCAM1 cDNA probe on Southern blots (VCAM1-1; Helm et al., 1994). This polymorphism was not informative enough to map VCAM1. To develop PCR-based genotyping, we sequenced the 3¢ untranslated region of pig VCAM1. Subsequently, a pig VCAM1 cDNA was deposited in Genbank; our data agree completely with that reported by Tsang et al. (Accession: U08351). The PCR primers were designed (forward, 5¢TATCAGCCCTCCATAGTCACAT 3¢ and reverse, 5¢GAAATTGTTGTCCATGACCTTTAT 3¢) .
منابع مشابه
Genetic and Physical Mapping of the pig Vascular Cell Adhe-
and Implications We have developed methods to identify genetic differences at the VCAM1 gene in pigs. We identified significant variability in Chinese and American breeds, with three different forms of this gene and five of the six possible resulting genotypes seen in Duroc and Landrace breeds. This variability was used to map the VCAM1 gene to pig chromosome 4, a chromosome with important quan...
متن کاملVariants in the VCAM1 gene and risk for symptomatic stroke in sickle cell disease.
Stroke is a major cause of morbidity and mortality in sickle cell (SS) disease. Genetic risk factors have been postulated to contribute to this clinical outcome. The human genome project has substantially increased the catalog of variations in genes, many of which could modify the risk for manifestations of disease outcome in a monogenic disease, namely SS. VCAM1 is a cell adhesion molecule pos...
متن کاملCandidate genes that determine response to salt in the stroke-prone spontaneously hypertensive rat: congenic analysis.
The existence of blood pressure quantitative trait loci exaggerated by salt on rat chromosome 2 has been confirmed previously using congenic strains derived from stroke-prone spontaneously hypertensive rats (SHRSP) and Wistar-Kyoto (WKY) rats. This study aimed to dissect the implicated chromosome 2 region and to identify candidate genes based on microarray expression profiling and real-time PCR...
متن کاملRapid communication: SacI restriction fragment length polymorphism in a porcine vascular cellular adhesion molecule (VCAM1) gene.
Probe Source and Description. A randomly selected 1.3-kb cDNA clone (S28) was isolated from a porcine spleen library (CLONTECH j. Amplification and hybridization analysis (previously described; Tuggle and Schmitz, 1994) indicated S28 was specifically expressed in spleen. A 504-bp BgZII-BarnHI subclone of S28 was sequenced and identified as a porcine vascular cellular adhesion molecule ( VCAM) c...
متن کاملExpression of ICAM1 and VCAM1 Serum Levels in Rheumatoid Arthritis Clinical Activity. Association with Genetic Polymorphisms
To investigate the association of sICAM-1 and sVCAM-1 with ICAM1 721G>A and VCAM1 1238G>C polymorphisms and rheumatoid arthritis (RA) clinical activity, sixty RA patients and 60 healthy non-related subjects (HS) matched for age and sex were recruited. Soluble adhesion molecules were determined by ELISA technique. Rheumatoid factor (RF), C reactive protein (CRP) and the erythrocyte sedimentation...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Journal of animal science
دوره 75 8 شماره
صفحات -
تاریخ انتشار 1997